Back
Back

Subacute Necrotizing Encephalopathy (Yorkshire Terrier Type)

Subacute Necrotizing Encephalopathy (Yorkshire Terrier Type) is a genetic neurological disorder in dogs causing progressive brain damage due to impaired thiamine transport, leading to severe neurological symptoms and early euthanasia.

Affected Genes: SLC19A3

Inheritance: Autosomal Recessive

Variant(canFam6):
chr25:41035314: 5 bp deeltion CACGGG, 35 bp insertion GCAGCAGCACCAGATAAGACATAGTCAGTGAGGAT

Breed: Yorkiepoo
Yorkshire Terrier

Variant(canFam6):
chr25:41035314-41035319: ALT>REF

References:
Baiker K, Hofmann S, Fischer A, Gödde T, Medl S, Schmahl W, Bauer MF, Matiasek K. Leigh-like subacute necrotising encephalopathy in Yorkshire Terriers: neuropathological characterisation, respiratory chain activities and mitochondrial DNA. Acta Neuropathol. 2009 118(5):697-709.

Drögemüller M, Letko A, Matiasek K, Jagannathan V, Corlazzoli D, Rosati M, Jurina K, Medl S, Gödde T, Rupp S, Fischer A, Luján Feliu-Pascual A, Drögemüller C. SLC19A3 Loss-of-Function Variant in Yorkshire Terriers with Leigh-Like Subacute Necrotizing Encephalopathy. Genes (Basel) 2020 11(10):1215.